MgSTS833

Genetic marker
Map(s): Not Mapped
Forward primer: GGATTAAAGTCCACAAGAGAGC
Reverse primer: GCCATCTGGCGTCCTAGC
Tm: 57.1
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5462 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 284-405 bp
GTTTATCGAAAGGAGGTAGGCCCCACTCACTAGGATTAAAGTCCACAAGAGAGCTTAAA
ACCTGATCAGCAGTTTCGTGATAAGAGCTATCCAGCCTTGGATCTGGAACCATGATCGCT
GACA

>Exon-2 406-485 bp
ATGCCAGCATTCTTAGCTGCTAGGACGCCAGATGGCGCATCTTCAAAAACAAGTATCTT
TTTCGGATCAACTGGTCCGCCC

>Exon-3 486-633 bp
CTCGAATCTTTTGGCTGCTGCAAGGAATATATCCGGCGAAGGTTTCCCTTGTTTAACTTCC
GGATCATCACCACGTACAATATGATGCATCAGTGAGAAAAGTTCACCGTGTCTTTGTGTT
TTCAATTCAAAATGCCTCGTGTGTGAAC

>Exon-4 634-694 bp
CCCGTTGCAACAGAGATAGGTATTCCATTCGCATGTAGGTGCTGAATCAAACGGCTGGCCC
C

>Exon-5 695-769 bp
CTGGCATGAGTTCACTTGTGGGGGAACATAGTTTGGAGCATATCCTCCCTCTCTACAGAAA
ATCTTCAGCTGAGAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: