MgSTS832

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)13 69.01cM

Forward primer: TTGCATACTTCGTCGTCAGG
Reverse primer: GAAACAGCACAGACAGGTAATCC
Tm: 59.9
Physical marker
Overgo sequence fw: CTGTTTGCATACTTCGTCGTCAGG
                ||||||||
Overgo sequence rv:                 AGCAGTCCCAACCTAGAAGGGTAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MlFPC1071
ML__Ba091I11
Set: C
Pools: 4,6,11
View Map
Sequence
Unigene: MgU5442 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 84-145 bp
GGGTCAGCAGATTTAGGTGTCTGTTTGCATACTTCGTCGTCAGGGTTGGATCTTCCCA
TG
AAG

>Exon-2 146-198 bp
GGTTGTGGATATGTTTGGCTGTGGATTACCTGTCTGTGCTGTTTCATATTCTTG

>Exon-3 199-274 bp
GTATAAAGGAGCTGGTAGATGTTGAAAAGAATGGCCTTCTTTTCTCGTCATCTTCAGAACT
GGCTGATGAACTCATG

>Exon-4 275-403 bp
GATGTTGTTCGAGGGTTTTCCAGAAAAATGCAATGCATTGAAGTCGATGAGGTCAAACTTG
ATGGAAAGGGTATCTTCAGTTAGGTGGGCAACAACTTGGGAAGGACATGCCAAGCCTTTA
ATAACCGAT

>Exon-5 404-414 bp
TGTTATCGCAGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: