MgSTS831

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 2.83cM

Forward primer: TTAATGGCTTCGGAATTTGC
Reverse primer: TGCTTTATCGTATGCGTTGG
Tm: 60.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5426 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 85-102 bp
XXGGGTTCCGACTCAAAAG

>Exon-2 103-272 bp
GGAGTTGAGACAACCCGACATTTCTTGCTGGAATGGCTGAGTTACACTTTCAGATATGTAC
CAGTTGGGCTCTTAGAAGTTATCCCACAAAAGATCAATTGGCGGCCACCCTCGTATTTCG
GCCGTGATGAGCTTGAGACCTTAATGGCTTCGGAATTTGCTGCTGATTGG

>Exon-3 273-370 bp
GATTAGGATATCTGAGATGTTGCTTGGCAAGGTGCCTTCTGGGTTCACATTTTCTCCTAAG
CACAAGTCCAACGCATACGATAAAGCAGAAAATGGCTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: