MgSTS830

Genetic marker
Map(s): Not Mapped
Forward primer: CCAATTGTCAGCAAGGAAGG
Reverse primer: AATGTCCAGGCGAAAATGC
Tm: 60.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU5402 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 85-134 bp
XXGGTGGTGCAGGGTTTTACCGTTGACTTAAACAAACCTCTCGTTTTCCAG

>Exon-2 135-228 bp
GGTTGGCCATCTTGGTGAAGCTTATCAGGAGTGGGTTCACCAGCCAATTGTCAGCAAGGA
AGG
CCCTCGTTTTTTTCAAAAGTGATTTTTGGGAG

>Exon-3 229-425 bp
GTATTTGACACGGAACGAATGGTGGGTGATTCCCCTTATTTGGCTCCCGGTTGTTTGCTGG
TCCCTTTCAAGAGCCGTTTCTTTTGGCAATACAATTCCCGAGGTGGTATTATTGACAGTA
TTTGGCATTTTCGCCTGGACATTGGTCGAATATACCCTTCATCGCTTCCTTTTCCACA
TTGAGACAAAGAGTTATTG

>Exon-4 426-531 bp
GGGGTAACACAATGCATTATCTTATCCATGGTTGTCATCATAAGCACCCAATGGATGGTCA
ACGCCTTGTTTTCCCTCCTGCTGCTACAGCTGTGCTTTTATTCCCA

>Exon-5 532-679 bp
ATTCTGGAATTTGATAAAATTAATTTCCACTCCGATGACTGCTCCTGCTGTATTTGGAGGG
GGTCTACTGGGATAGGTGATGTACGACGTAGCTCATTACGAGATGTAACATAGCGCGCGC
ACAGGTGGATTCCCGCAGGAATCTAAGG

>Exon-6 680-709 bp
GAAATTTGTTCCAAAATCATCAATTTCGGAG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: