MgSTS83

Genetic marker
Map(s): Not Mapped
Forward primer: CAGCTTTACAAGGGCCAAGA
Reverse primer: GTTCATCCTTGAGCCCAAAATA
Tm: 0.0
Physical marker
Overgo sequence fw: GAATACAAAGGACCACGAGAGGCA
                ||||||||
Overgo sequence rv:                 CTCTCCGTCTACCGTAACACTGGA
Tm: 65.4
Set: D
Pools: 2,9,12
View Map
Sequence
Unigene: MgU658 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-179 bp
AAAGGTTTCCCCACAATTAAAATACTGAGATATGGAGGTAGCGTTGTTCAGGAATACAAA
GGACCACGAGAGGCAGATGGCATTGTGACCT
ATTTAAAAAAGCAAAGCGGCCCTGCATC
TAATGAAATTAAATCTGGTGAAGATGCTAGTTCTATAATTGACGATGACAAGATTCTTGT
T

>Exon-2 180-368 bp
TGTTGGTGTATTCCCGGAGTTTTCTGGAGAGAAGTTTGAGAATTTCACAACCCTGTCTGAG
AGATTGCGCGCCGACTATGAGTTTGGTCATACTTTGGATGCCAAACATCTTCCTCGTGGG
GACTCATCAGCTGCTGGACCTTTTGTTCGTTTGTTTAAGCCTTTTGATGAACTCGTTCTA
GATTTCCAG

>Exon-3 369-494 bp
GGATTTTGATGTCGATGCTTTAGTGAAATTTGTTGAAGAAAATAGCATCCCTACCGTAACC
CTCTTTAACAAGGATCCAAAGCACCATCCTTTTGTTATTAAATTCTTCAACAGCCCCAAC
GCCAAG

>Exon-4 495-632 bp
GGCAATGTTGTTCTTAAACTTCAGCATTGAGCAGTTTGATTCGTTTAAATCGAAATATCAC
GAGGTGGCTCAGCTTTACAAGGGCCAAGACTTGAGTTTTCTAATGGGTGATATTGAGG
CTAGCCAAGGTGCCTTTCAG

>Exon-5 633-688 bp
GTATTTTGGGCTCAAGGATGAACAAGTTCCTCTTATCATCATCCAGACTAATGATGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: