MgSTS829

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 140.54cM
M. guttatus IM62_x_DUN RILs(2009)8 112.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 127.50cM

Forward primer: CATCAAACCAGGTGAAATCG
Reverse primer: TAATAAGCGGGTCCATGAGG
Tm: 59.0
Physical marker
Overgo sequence fw: CCGACTGTGTAGTCATTGTCGTTG
                ||||||||
Overgo sequence rv:                 ACAGCAACTACGAACATCTGGTGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC283
MG__Bb096K18
MG__Bb092L07
MG__Bb058P09
MG__Bb071E06
MG__Bb093L12
MgFPC770
MG__Ba039E22
MG__Ba076I16
MG__Ba044B03
MG__Ba091F13
MgFPC995
MG__Ba036C03
MG__Ba015E09
MG__Bb030E01
MG__Ba042J09
MG__Ba060E13
MG__Ba080G19
Set: C
Pools: 3,10,15
View Map
Sequence
Unigene: MgU5394 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 89-177 bp
GATTCGATGATGATGAAGAATGTCCGAAGTGCTACTGTCAATGCCGACTGTGTAGTCATT
GTCGTTGATGCTTGTAGACCACC
TCAAAAG

>Exon-2 178-288 bp
GATTGAAGAAGTTTTGGAAGGAGTGGTAGAGATCAAAGATAAGTTACCCACTCTTCTTGTT
TTAAATAAACGGGATCTCATCAAACCAGGTGAAATCGCTAAGAAAATCGAG

>Exon-3 289-414 bp
GTGGTATGAGAATTTTACGGAGGTTGATGAGGTCATACCTGTGAGTGCTAAATATGGCCAA
GGAGTTGATGACATCAAGGACTGGATTTTATCGAAACTTCCTCATGGACCCGCTTATTA
TCCTAAG

>Exon-4 415-513 bp
GGATATCACTAGTGAGCACCCTGAGAGATTTTTTGTCGCTGAAATTGTCAGAGAAAAAATC
TTTATGCAGTACCGAAACGAAGTCCCTTATGCGTGCCAG

>Exon-5 514-615 bp
GGTTAATGTGGTTAGTTACAAAACTAGACCAAATGCGAAAGACTTCATCCAAGTCGAAATT
GTCGTGGAGAAGAACTCGCAGAAGATTATCCTTATTGGAAAG

>Exon-6 616-696 bp
GGAAGGAAAAGCACTAAAGCTGCTAGCGACAGCAGCTCGATTAGACATAGAAGATTTCTTG
CAGAAGAAAGTATTCCTTGAG

>Exon-7 697-782 bp
GATAGAAGTAAAGGTGAAAGAGAACTGGCGACAGAACGAAGGGCTGCTCAAGTTTTACGGA
TACGGAGGGCANATTCAAGCTATATG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: