MgSTS82

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)10 93.62cM

Forward primer: ACAAATCTCGTGCAGGGTCT
Reverse primer: ACGGTTTCCGAAAGTGTACG
Tm: 0.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU645 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 213-591 bp
ACTAACGATCGACGCCTTCAATCTTGTCCTCCACTTCAGAGTAGAGCTGCTTCAATCTCTC
GATATTTTCTTCGGAAGTTTCCCAGTACCCTCTTCCATTAGCCTCCAAGAACGTCTGGAC
CAACTTCCGGAAGGAATTAGGGTTTGTGCTCATGAGCCTGTTCAGCATTTCCTCGTCTTG
TACGAAAGTTGTGTTTGCTTCTTCGTACACCCAATTGTCCACCTGTCCTGACGTGGCACT
CCATCCAACGGTGTTTGTTAGCCGTTTCTCGATTTCGCGGACACCCTCGTAGCCACTCGA
TAGCATGCCCTCGTACCATTTTGGATTCAACAATTTCGTTCTTGCATCCAGACGAACGG
TTTCCGAAAGTGTACG
AACC

>Exon-2 592-734 bp
CTGAGCATTAGCAGTGGTGGTATCAGCAATGTAAGCACTAGGCTTCTTCCCATCCTTCCNA
AGACCCTGCACGAGATTTGTGGGGTCCGAATCAAAGTAGTGACTGACATCTGTCAGTG
AAATCTCTGACGAGTCGAGGTTCTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: