MgSTS81

Genetic marker
Map(s): Not Mapped
Forward primer: TGCTGCTACCAGTGAGTTGG
Reverse primer: TTCCCGATAATGAAGCCAAG
Tm: 0.0
Physical marker
Overgo sequence fw: GCTGTCAAGACTCCGGTGCATGAA
                ||||||||
Overgo sequence rv:                 ACGTACTTAGTACGAAGACCTTCT
Tm: 65.4
Set: D / D2
Pools: 2,8,15 / 3,9,13
View Map
Sequence
Unigene: MgU610 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 189-354 bp
CCATTACAATCTTCAGGTGCAGCAACGGACTCTCCCATGATTTCTTCGGGTCCAAAGGTTG
GTTTCACTTTGCAGTTTAGTGTTAAAGATTTGATGTCAAGGAGCAAGCAGAGGCTGTCA
AGACTCCGGTGCATGAATCATGCTTCTGGAAGA
TTTAAGTTACAAGG

>Exon-2 355-481 bp
GAGGTTTCGCTGCCGCATCATTGGAGCTTTCACAAGTAGTAAACGAAGAGGGGAAGGCTAA
AGCCTTAGCTGCTGCTACCAGTGAGTTGGAAAGACTGTCTAAGAAGGAAGATTTCAAG
CAAATGAAG

>Exon-3 482-550 bp
GGTTATAGGACAATTCAATCTTGGCTTCATTATCGGGAAGTTAGACCAGGACCTTTTTA
TAGTGGATCAG

>Exon-4 551-621 bp
GCATGCTGCAGATGAGAAAACAACTATGAGCGCCTTTCAGAACTACTGTTTAAACCAGCAA
CCTTTACTTCG

>Exon-5 622-672 bp
GGCCACTAACAATGGCATTAGCTCCTGAAGAACAGATAGCCATCTCCATGCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: