MgSTS80

Genetic marker
Map(s): Not Mapped
Forward primer: AAGGAGCTACGCTCGTCAGT
Reverse primer: CAATTGCAGAGCCTTTCTCC
Tm: 0.0
Physical marker
Overgo sequence fw: GCTGTGATATGGCGCGATGAAGGA
                ||||||||
Overgo sequence rv:                 TACTTCCTCTACTACTTTTAGGTC
Tm: 64.4
Set: D
Pools: 2,8,14
View Map
Sequence
Unigene: MgU581 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-127 bp
GCGAACAATTGCCTGCGTTTGAATGCTCAACGGAATCTCAATGATATTGCTGTGATATGG
CGCGATGAAGGAGATGATGAAAATCCAG
TAAATAAAATGACTGTTAAGGAGCTACGCT
CGTCAGT
TTG

>Exon-2 128-332 bp
GGCTTGTTGCCCATGCAATAGAAACTCTGAAATTGGAGAAAGGCTCTGCAATTGCAATA
GATATGCCGATGCATGTTAACTCTGTGGTGATCTACCTGGCTATAGTCCTTGCTGGTTAT
GTTGTTGTATCCATTGCAGATAGTTTTGCACCATCTGAAATATCTGTAAGGCTCAAAATA
TCAAACGCCAAAGCAATTTTCACTCAG

>Exon-3 333-373 bp
GGATGTCATCATTCGTGGTACTAGAAAACTTCCCTTGTACAG

>Exon-4 374-499 bp
GTAGAGTTGTTGATGCTCAGTCTCCAATGGCAATTGTAATTCCCAACAGAGATTCGAATTT
CAGCACGAAATTGCGTGATAATGACATTTCCTGGCAGAGTTTTCTTGAGAGAGCAACTGG
TTTCAA

>Exon-5 500-576 bp
AAGAAGTTGAGTTTGTTGCTGTTGAACAAACAACTGAAGCATTCACAAATATTCTTTTCTC
ATCAGGAACTACAGGGG

>Exon-6 577-674 bp
GAGCCAAAGGCAANTCCCGTGGAGTGTTGCTACACCTTTGAAAGCCGCTGCAGATGGATGG
TGCCACATGGACATACGCANAGGTGATATAATAGCTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: