MgSTS76

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)8 83.70cM

Forward primer: GATTTCCCGATCGTTGCTT
Reverse primer: AAGATCCACATCATGCACCA
Tm: 0.0
Physical marker
Overgo sequence fw: ATTCATATCGTCACCGAAAAAGGC
                ||||||||
Overgo sequence rv:                 TTTTTCCGTTTCCGATGGGAGGCC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1712
MG__Bb069J11
MgFPC2041
MG__Bb048I18
MG__Bb027D10
MgFPC273
MG__Ba048K02
MG__Ba024K18
MG__Bb056N08
MG__Bb095I06
MG__Ba022D07
MgFPC2779
MG__Bb070O01
MG__Ba038N16
MG__Bb018B16
MG__Bb074M02
MgFPC3005
MG__Bb062C22
MgFPC414
MG__Ba018E01
MgFPC604
MG__Bb062D05
MlFPC1205
ML__Ba055H11
MlFPC464
ML__Ba016D11
MlFPC472
ML__Ba066K22
MlFPC545
ML__Ba070L23
MlFPC680
ML__Ba041P11
ML__Ba033J08
MlFPC995
ML__Ba094M12
ML__Ba034E12
Set: A
Pools: 2,8,12
View Map
Sequence
Unigene: MgU1118 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 4-8 bp
GCAAAG

>Exon-2 9-282 bp
GAGCATAACAAAGCAAATTGGGCCACAAGCACACGAAGTCGCGGCAAAAGTCGACGAATAC
GCAAGAGGGATGCTTAGTGCCCCCGGTTCAACACTCTTCGAAGAGCTCGGATTATATTAC
ATAGGCCCGGTCGACGGCCACAACGTCAATGATTTAGTCACCATTTTCGAAAAGGTCAAA
TCCATGCCTGCACCCGGTCCAGTTCTAATTCATATCGTCACCGAAAAAGGCAAAGGCTA
CCCTCCGG
CCGAAGCAGCCGCTGACAGAATGCACG

>Exon-3 283-590 bp
GGTGTTGTGAAGTTTGATACAAATACCGGAAAACAAAACAAGGTGAAATCTTCGACGCTTT
CGTATACGCAATATTTCGCTGAGTCGCTTATAAAAGAAGCGGAGATAGATAGCAAAATCG
TGGCTATTCATGCTGCAATGGGAGGAGGAACCGGTTTGAATTATTTCCAGAAACGATTT
CCCGATCGTTGCTT
TGATGTCGGCATTGCGGAGCAGCATGCGGTCACGTTCGCAGCTGG
CTTAGCCACTGAAGGGCTCAAGCCGTTTTGCGCTATATATTCGTCTTTCCTCCAAAGAGG
ATACGACCAG

>Exon-4 591-673 bp
GGTGGTGCATGATGTGGATCTTCAAAAGCTACCGGTCCGGTTCGCGATGGACCGGGCGG
GTTTAGTTGGTGCGGATGGGCCCCG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: