MgSTS75

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 13.70cM
M. guttatus IM62_x_DUN RILs(2009)10 95.48cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)10 29.32cM

Forward primer: GGACATGTAGCGCTCGTAAT
Reverse primer: ATAGGTGCAAAAGCCGACAC
Tm: 0.0
Physical marker
Overgo sequence fw: CGAGTGATCGTAACCCGCTTGCAT
                ||||||||
Overgo sequence rv:                 CGAACGTAAGACTCATTGTCTCCT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1113
MG__Bb004I09
MG__Bb081L15
MG__Ba086F06
MG__Ba044K02
MG__Ba047J19
Set: A / 3x3x3
Pools: 2,8,11 / 1,7,14
View Map
Sequence
Unigene: MgU1116 (Build 1)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 159-341 bp
ATTATACATTAAGGGCTTGAACATGGCGACGAATGTGGTCGTCTATGAAAGTAACACTGGT
AAAGTACGAGTGATCGTAACCCGCTTGCATTCTGAGTAACAGAGGAACATTAGCTCTT
TCGACAAGCCTCACTCAAATATCTACGGTTTTAGTTGCTCACTCAAGAATTTATCATCAC
TTCCC

>Exon-2 342-407 bp
CTGATCGATGAGGATAGTTGTCGAAAGATTATTGTATTTCGATATAAGCAGCGTGGCGTCA
TATTGC

>Exon-3 408-506 bp
CTCCCAAGCAGATTTATTTTCGCCCAAGTAATTAGTGAAAGCTTTGTGGCCCCACGGACAA
TTTGTAGGATTCACAATAGGTGCAAAAGCCGACACCGAC

>Exon-4 507-661 bp
CTTGTATTTGACCAAATTTTTAAGGTANATTACGAGCGCTACATGTCCGCCCATCGAAT
GACCAAATATAGACGCTCGAGTTGTGTCGAGCTGTGGGAAATTTTCGTGAACGAGCGCCG
GTAGTTCCTTCACAATGTAGTCGTACATTCGCCAGTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: