MgSTS74

Genetic marker
Map(s): Not Mapped
Forward primer: AAGGCAGATCTCCTCCCATT
Reverse primer: AGCAGACTTTGCTGACCAGA
Tm: 0.0
Physical marker
Overgo sequence fw: GACTGCAGACGAGCAAGTAGCTCA
                ||||||||
Overgo sequence rv:                 CATCGAGTAGGGACGGTATATCAA
Tm: 65.4
Set: D
Pools: 2,7,15
View Map
Sequence
Unigene: MgU1097 (Build 4)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 0-693 bp
N

>Exon-2 694-758 bp
CTCACGGAAAATGGGAGGAGATCTGCCTTGTTAACAGAAGCATGTCCTTTTGTGTTCAT
CGATCTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: