MgSTS73

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)4 51.47cM
M. guttatus Irn Mtn Combined(2009)7 13.92cM

Forward primer: TTTTCGTCAGGCATGGAAAG
Reverse primer: AATTCGACCCTGAGATTGGA
Tm: 0.0
Physical marker
Overgo sequence fw: CCTACGGATGGGTTGCGTATATTT
                ||||||||
Overgo sequence rv:                 CATATAAATGCCCAATGGAAGAGG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1666
MG__Ba004N01
MG__Ba002I16
Set: D
Pools: 2,7,14
View Map
Sequence
Unigene: MgU1016 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 1-111 bp
AAAACCAGGCGAAAGCTGACGCTCCCTACGGATGGGTTGCGTATATTTACGGGTTACCTT
CTCC
TTCTTCCGACTAAGAAGTTCAGTAGCTTTAATTGATTGACTAACAGCC

>Exon-2 112-291 bp
CTTCTCTTTTTTCTCCTTCTCTCTCTCAGGGTCGATGTCAGTGACGCAGTTCTTGACTTTG
TAAACCTTTTTGTTGCGTGAATCAACAAGTGCGGTCAATAAACGATGAGATTTTGAAGTC
AAGGATGATGGCATAAACCTCATTTTTGATAAAATTCGACCCTGAGATTGGAGAATAC
CC

>Exon-3 292-423 bp
CTTTCCATGCCTGACGAAAA
GGTGTGCTTGTTCGTGTTGAGCATCTTGCTTAGATATATC
AAGCACTTCGTTTCCAATAAGTAACTGCAGACTCCCATCTGACCATTCCACAAAGCGAGC
ATTGCTTTCAATA

>Exon-4 424-600 bp
AGATGATGTGCCATCTGGTTTTTTGACCTTCCTCCACCGAACAACATTATTCTCTAGCCGT
ATCCGCTTTTGTGATCCAGATTCGTCGGTTACATAAAGATCCTCTTCCACATATGTGTGA
GGATCGAAAGGTTTAGGATCTACCCCCATTATATTAAAAACTTTGATCATATTCATC

>Exon-5 601-734 bp
CTTGTTGGATTCAGCTGGAGGTTGGCACAAAGGAATTTCCAACTCCAGTGGCGGACCAGTT
GGGTTTTTCTTGAGCTTAGCCTCGGCCTGCTCTTCTTCAGAGTAGGACGGACCATCTTCA
TCGTGTATTATATC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: