MgSTS72

Genetic marker
Map(s): Not Mapped
Forward primer: ATGCGATACGGCACTATTCC
Reverse primer: AGTCCCTTCACCGCTACCTT
Tm: 0.0
Physical marker
Overgo sequence fw: CCCATGATGGCTTGTGCTCTTTGT
                ||||||||
Overgo sequence rv:                 GAGAAACATACAAGGCTGCCGATA
Tm: 65.4
Set: D / D2
Pools: 2,7,13 / 3,9,11
View Map
Sequence
Unigene: MgU971 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 194-347 bp
CGGCGTAAGGAGGGTCGATAAATGCCCATTCGAAAACTTGTTCGTACTGAGTGGCTGCCTT
ATCCCAAGACGAGTCTCTCTCCATTCCCCGTTTCATTAATCCTTCCCATGATGGCTTGT
GCTCTTTGTATGTTCCGACGGCTAT
TCTTAGTGTA

>Exon-2 348-387 bp
AGCTAGTAAACTCTCTTTCGACAGAGGAGAAAACGCCCACC

>Exon-3 388-443 bp
CCAGTCCCTTCACCGCTACCTTCCTTTGCGTATGGATCGAACGTCTGAACTGTGTCC

>Exon-4 444-552 bp
CCTAAGACCGCCAGTGCTGTGAACAACGGGAATAGTGCCGTATCGCATTGCATACAACT
GATTTAGACCACATGGTTCGAATCTTGACGGCATTACCAATATGTCACAAC

>Exon-5 553-677 bp
CCTGCAGTGATCCTATGTGAAATCGGAACATTGAATCCAACCCAACCTCGAAACTTGTCTT
TATAAACCTCCTCTAATTGTCTCATCCAGCCTTCGTATTGTTTTTCCCCGGATCCAAGCA
TTACA

>Exon-6 678-706 bp
AAATTGGACATCGTCTTGCAGAAGTTCTGG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: