MgSTS71

Genetic marker
Map(s): Not Mapped
Forward primer: GATTTTGCCAGATGGAGAGC
Reverse primer: CACATGTCACCGATGACTCC
Tm: 0.0
Physical marker
Overgo sequence fw: CCTTTCAAGAGTATCAGCCGTAGG
                ||||||||
Overgo sequence rv:                 CGGCATCCTTTGGCAGACGTTGGA
Tm: 65.4
Set: D2
Pools: 3,8,15
View Map
Sequence
Unigene: MgU970 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 154-286 bp
CTCAAGACTTGCAAAATGCATGGAGTGTGTCATCAAGGGCTTTTCTGTCATAATCACCGGT
GAAAACACAATTTCCGAGTGGACCTTTCAAGAGTATCAGCCGTAGGAAACCGTCTGCAA
CCT
TTTTATCAACC

>Exon-2 287-430 bp
CGCCATGACAGACTTAAACATTTCGACAGTCATGGCTTCTGGTAGCGTTGTCGGTAATTTA
GCCTGCTGCAAAATCATATCCACCCGCTTTACTAACGATTCGTCAATCCAGCCTAGCCTG
TGCGACATGTCAACCGCCATTACT

>Exon-3 431-493 bp
TGTTCCAGCGGCAACAGCCTCCCCGTGAAACCAATGCCCATATCCAGAACTAGTCTCGATT
GCA

>Exon-4 494-617 bp
ATGACCAAAAGTGTGACCCAAGTTTAGTGTTGCCCTCAATCCACTCTCCTTCTCATCCAAG
GACACAACCTCAGCCTTATTCTCACACGAGCGCTTTATAGCATAAGAGAACGCATTCGGG
TCCC

>Exon-5 618-699 bp
CTTGCCAGCAAGGCGTGCATATTCTTTTCCTGCCACTCGAAAAATTTAGCATCTCTAATAA
GTCCATATTTAATGACTTCTGC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: