MgSTS707

Genetic marker
Map(s): Not Mapped
Forward primer: TTTACTGAACGAGGGGATGC
Reverse primer: TCAGGAAGGCCATCTTTACG
Tm: 60.1
Physical marker
Overgo sequence fw: CCCCACCTCCGTTTCCTACCACTA
                ||||||||
Overgo sequence rv:                 ATGGTGATGGAGGTTATTCTGTAA
Tm: 65.4
Set: B
Pools: 4,10,14
View Map
Sequence
Unigene: MgU6051 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 1-94 bp
TCCCCACCTCCGTTTCCTACCACTACCTCCAATAAGACATTTGTCGACTTGATTCTGAA
GCCCACTGAAGTGGACATGAAAATTTGGCCCAATAG

>Exon-2 95-235 bp
GTTTTGAGTTCCGTCTGCGAGTAACTCTGGGACCTGCTGGTGATCTGATGTTGACTTCTCG
CATCAGAAACACTAATAGTGATGGAAAGCCTTTTTCATTCACATTTGCTTATCACACCTA
TTTCTCTGTCTCTGATATCAG

>Exon-3 236-338 bp
GTGAAGTACGTGTCGAAGGGTTGGAGACACTGGATTATCTTGACAATCTGCAGAACAAACA
GCGATTTACTGAACGAGGGGATGCAATAACTTTTGAATCAGAA

>Exon-4 339-438 bp
AGTGGACAGGATATATCTAAGCACACCTACAAAGATTGCTATTCTGGACCATGAAAAGAAG
AGAACCTTCGTCATTCGTAAAGATGGCCTTCCTGATGCTG

>Exon-5 439-643 bp
GTTGTGTGGAATCCTTGGGATAAGAAGGCAAAGGCAATTGCCGACCTTGGAGACGAGGAAT
ATAAGTATATGCTATGCATCGAGGCAGCTGCAGTCGAAAAACCAATCACTTTGAAGCCCG
GTGAGGAGTGGAAAGGTAGGCAGGAACTTTCTGCCGTGCCTTCAAGTTATTGCAGTGGGC
AGCTTGATCCTCGCAGaGtCCTCCT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: