MgSTS705

Genetic marker
Map(s): Not Mapped
Forward primer: TGGCCAATTCTCTTCTACTCG
Reverse primer: GGTTAGCTTCCATTGTTGTCG
Tm: 59.5
Physical marker
Overgo sequence fw: GGAAGCTAACCACACTGAAACAAC
                ||||||||
Overgo sequence rv:                 CTTTGTTGACGTGGTGGAGGCATT
Tm: 65.4
Set: B
Pools: 4,10,13
View Map
Sequence
Unigene: MgU3082 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 312-375 bp
CAACCGTTCCAGCAATCTTTTTCTATAACGCTTCTATGTCCGTGGCCAATTCTCTTCTAC
TCG
AC

>Exon-2 376-447 bp
CTTGAAAAGAAGGTATCGGTATACAAACCAACCAGTGTATCCAAGCCCAACCAACTCCATG
ATTTTTGGAAGC

>Exon-3 448-555 bp
CACAGGGACAGAGTTGATTGcacCGACAACAATGGAAGCTAACCACACTGAAACAACT
GcacCACCTCCGTAA
AgaAGTACAGTagaCTTGTTTTCAACGGCATCCCAC

>Exon-4 556-605 bp
CTTTTCCTTTAGGTCTgtgAACAAtTCATTTGCATCaaGAgggCTCTCGTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: