MgSTS701

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)14 58.60cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)14 97.19cM

Forward primer: CATCATGCATCAGATCAAACG
Reverse primer: CCAAGTACCTTGGCTTGTGG
Tm: 60.1
Physical marker
Overgo sequence fw: CCTCAGGCAGACACCATCATGCAT
                ||||||||
Overgo sequence rv:                 AGTACGTAGTCTAGTTTGCGAAAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1681
MG__Ba096N02
MgFPC251
MG__Bb066L14
MlFPC1210
ML__Ba060N09
MlFPC32
ML__Ba023E07
Set: C2
Pools: 3,6,13
View Map
Sequence
Unigene: MgU1951 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 152-257 bp
TGCTAAGCACAACCCTCAGGCAGACACCATCATGCATCAGATCAAACGCTTTGTTTA
TGTCTGGAAGAGTCATGTTATGGGTGATGTACTCGTCAACTTTGATTTCT

>Exon-2 258-419 bp
TTTCTTCAGATACTTCTCCACAAGCCAAGGTACTTGGGAGCGGCTCTTGAACCCGCCAA
ATGCGGTACCCTTCCAGACCCGACCCGTTACCAGCTGAAACGGGCGGGTCGAGATTTCTT
GACCCGATGCAGCGACACCCACAATAACGGATGTTCCCCATCCC

>Exon-3 420-577 bp
CTTATGGCAGCACTCTAAAGCGGCCCTCATTACAGAGACATTACCAATGCACTCGAAACTG
TAATCAACTCcacCGTCGGTTAAATCCGCAATGACTTGCTGGATCGGTTTCTCGTGGTCT
TTTGGGTAGATGAATTCAGTcacACCAAAGTTCTTTGC

>Exon-4 578-653 bp
CTGTATCGAACTTTTTGgtgtcaaTATCTATCCCAATTATccgcgaagcgccAGCAGCTTT
TGCACCCTCTgccaca

>Exon-5 654-673 bp
agcaaGTccaacAGTgcctag



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: