MgSTS70

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 17.20cM

Forward primer: CTTGCTGATGTTTTCGGACA
Reverse primer: GAATTCGTTGCGAAATGGTT
Tm: 0.0
Physical marker
Overgo sequence fw: CGAGTGTCGATTGGCTGATGCTAT
                ||||||||
Overgo sequence rv:                 CTACGATATGAGACTATAAGGTTC
Tm: 63.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2800
MG__Bb094F16
MgFPC2932
MG__Bb018H19
MG__Ba010K14
MlFPC1552
ML__Ba071C16
MlFPC157
ML__Ba065I04
MlFPC189
ML__Ba066A08
MlFPC337
ML__Ba019D04
MlFPC384
ML__Ba062F12
MlFPC406
ML__Ba041G01
MlFPC470
ML__Ba039O13
ML__Ba087O09
MlFPC527
ML__Ba083K09
ML__Ba038P22
ML__Ba059G23
ML__Ba043O20
ML__Ba032G24
MlFPC560
ML__Ba018B12
MlFPC579
ML__Ba008P06
MlFPC615
ML__Ba049A05
ML__Ba042L20
ML__Ba080D16
ML__Ba029G19
ML__Ba081L14
ML__Ba093J10
ML__Ba057G19
ML__Ba029M01
MlFPC840
ML__Ba019A22
Set: A
Pools: 2,7,15
View Map
Sequence
Unigene: MgU968 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 153-235 bp
ATTAAGAATTCGTTGCGAAATGGTTGAATATAGTTTCGAGTGTCGATTGGCTGATGCT
ATACTCTGATATTCCAAG
TTCATTTC

>Exon-2 236-294 bp
CTGTTCCTCTCCATGTGTCCGAAAACATCAGCAAGAGAAAGGTCTTCATGGTACGGCAG
C

>Exon-3 295-428 bp
CTGGTATTTAACACTCAAGCCATCACAACTTTGATAAGTCGAACCGGGGAACGATGATTGA
ATGAACGAATCAATTACCGCAAACTTTTCTTTGGTTAACCACCACTCCGAAAATACCGGC
AATTGTATACCACC

>Exon-4 429-674 bp
CGCTACGAAGTAACAGCTCCGACAACTGTTCATCCAAGACACCACAAGAATCACTATCGCC
AGATACGAGAGCCTCCACTCTTTCTTCATTGGCAAGCCACCTTCCAATAGGTAAAACCAT
CTCGTTCGACCAAGCTGATTTCTGCAGCTGTCTCGCCTAAATACCTTCGATACCCCCCAT
GCAAACCTCGAAGCCCGTTAGCACCCTTCCTGCGTCGACACGAACCCCCACCACACTTTC
CTGAAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: