MgSTS7

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)5 0.00cM

Forward primer: AATCGCCTACTCCTCCCATC
Reverse primer: TCCTTAGCTTGTCGGCAGTT
Tm: 0.0
Physical marker
Overgo sequence fw: CCAGCTGGTAAAGATCGCCTCGTC
                ||||||||
Overgo sequence rv:                 CGGAGCAGAAACGAAGAGATTACC
Tm: 65.4
Set: D
Pools: 1,7,11
View Map
Sequence
Unigene: MgU151 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 290-369 bp
TTTATTCGGAGTTCAATCTTTGGACATCTACCAGCTGGTAAAGATCGCCTCGTCTTTGCT
TCTCTAATGG
AAGGTTTGTTC

>Exon-2 370-452 bp
CTCCTAAGTTCAATCTGCGAATAATCAATTTCTGATATGATTATTGCCTCGTCATGTTCGG
TTGTGGCCAGCACTTCTCCAAAA

>Exon-3 453-533 bp
AGGGCCGACGAGTGTAGAATGACCCCAAGCAACATATCCAGCATCAGCATCTCGAGCAGGC
GAACAAGTTGCTACGTATAAC

>Exon-4 534-549 bp
CTGATTGTCCACAGCCC

>Exon-5 550-628 bp
CGTGCCCGTTGTAGTAATTCCCAGTGCagaGGTCCTGTAGTCATGTTGAATGCTCCAGGAT
AGCAAATCAATTGAGCACC

>Exon-6 629-703 bp
CTCTTGCTGCATAAAGCATAgccagTtCTTGAAATCGAATGTCGTAGCAGATACCTATTCC
AATTCGACCAACCTC

>Exon-7 704-797 bp
CTGTGTCTACTGTAGTGGGAGTTTCTCCAGCTGTAAGAGtCTTCGATTCCTTGAACGTAAT
CTTCCCAGGAATATCGATATCAAAAAGATGTATC

>Exon-8 798-1023 bp
CTTACGATGTTTAGCTTTCAGGTTTCCATCGGGTCCGAATACACAGCACGTGTTATACAAT
TTCCCGCCACTTTTTTCCGGAATCGAACCTCCGATTATCGTAATTTTAAGAAGACGCGCA
ACTTCAGACAACATTGCTGTCGATGGAGATGCATCGAAACCGGAATCAATATCCTCAGCA
TACACTGGAAANACTATCATTCGAGTATGGACTATTCCATATTTCG

>Exon-9 1024-1140 bp
GGGCAACACAACAAGCTTTGCGCCCTTCGCGGCAGCTTCCTCTAATGCAGTACGAGTATGT
AAAATGTTCCTTAGCTTGTCGGCAGTTACTCTCAATTGGCATAATCCAATTTTAAAC

>Exon-10 1141-1220 bp
CTTAGTGATGGGAGGAGTAGGCGATTGGATCGCTGGAGGAACCCGAGCTTTTTCCGGGT
AGAAAGAGGAAGACATTGACGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: