MgSTS693

Genetic marker
Map(s): Not Mapped
Forward primer: TGTGGCGTTGACATACTTCC
Reverse primer: CGGTAGATCCACCACATAGG
Tm: 59.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU4329 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 1-309 bp
ATTGCAGGAAAGAATAGTAAGGCAGAGTTTCAAGCTCCAGTTCGTACCACAAAATATCCTA
GAGAGATTCCACCGCTACCTTGGTACCGTTCAACCGTGCCTCAGNATGGCTATNGGCCGG
CTTCTTGCCATTCAGCGCAATCTATATTGAACTGTACTACATATTTGCCAGTGTCTGGGG
TCACAGGATTTACACCATTTACAGTATTTTATTCATTGTCTTCATTATTCTCCTGATCGT
CACTGCGTTTATTACTGTGGCGTTGACATACTTCCAACTTGCTGCTGAAGATCATGAA
TGGTGGTGGAG

>Exon-2 310-528 bp
GGTCTTTCCTATGTGGTGGATCTACCGGCTTGTTTATCTATAGCTACTGCCTTTATTAC
TACTATGCGCGATCGGATATGTCAGGCTTCATGCAAACCTCATTCTTCTTTGGGTACATG
GCTTGTGTATGCTATGCTTTCTTCCTAATGCTCGGAGCTGTTGGTTTCCGTGCTGCTTTA
TTCTTTGTGCGCCACATATACCGCTCGATAAAGTGCGAATG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: