MgSTS69

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 15.32cM

Forward primer: GAGGAAGTGGGAGACGACAA
Reverse primer: CCTTCCAACGATCCAATCAT
Tm: 0.0
Physical marker
Overgo sequence fw: CGAATAGTTCTGTCACTGCTGAAC
                ||||||||
Overgo sequence rv:                 ACGACTTGAACATCCTTGGACGAC
Tm: 64.4
Contig BAC
BAC contig and clones containing marker:
MgFPC126
MG__Bb077F03
MG__Bb093L17
MlFPC337
ML__Ba013E17
MlFPC842
ML__Ba065N17
Set: A / 3x3x3
Pools: 2,7,14 / 1,7,13
View Map
Sequence
Unigene: MgU967 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 278-392 bp
AATTTATTTCCAACGGTTCAATGTTCCATATGTCGTTAGCGTACTCACGAATAGTTCTGT
CACTGCTGAACTTGTAGGAACCTGCTG
TATTCAATATCGACATCTTTGTCCATCTC

>Exon-2 393-593 bp
CTTTTGATCCCTATAAGCAATATCAACCTTGTCTTGGCATTCAATGTAGCTAGGGAAATCC
TTGCCCACCAGGAAATAGTCTGCACGCCCGAATCCTTCGTTTCCTTCCAACGATCCAAT
CAT
TTCATCATAGTTATAAGCCCCAAAAGCACCACTTCTCACAAACTTCTTCACTTCTT
CAAAGCGTTCATCTGGTACAAAC

>Exon-3 594-712 bp
CTCGCCTGCAGCTCTTTCGTTTCTAAGTGGTGCTATCTCGTGAGCTTGAGCCCCGAANAGG
AAGAAATTGTCGTCTCCCACTTCCTCCCTGATTTCCACATTGGCACCATCTAAGGTCC
C



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: