MgSTS68

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 137.40cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 104.31cM

Forward primer: AGTGCAACTGAAGCAGCAAA
Reverse primer: CTACAACATCCGCATCATCG
Tm: 0.0
Physical marker
Overgo sequence fw: TCGACGAATCCAACCTACTCCTCC
                ||||||||
Overgo sequence rv:                 TGAGGAGGTTCGGCGATTTATGTG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC7
MG__Bb062A18
MlFPC734
ML__Ba056H04
ML__Ba075D13
ML__Ba085K12
Set: A
Pools: 2,7,13
View Map
Sequence
Unigene: MgU927 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 83-165 bp
AGAAGAGCAAATTCACTTCCAATGGCGGTTCGCTCGTGCCTCTTCGACGAATCCAACCTA
CTCCTCCAAGCCGCTAAATACAC
T

>Exon-2 166-293 bp
TGTGGATACGTACGTGGAGAATGGAATGGTGGTAGGGCTGGGATCTGGTCGGGCTTCTGGT
TTTGCTATACAGTATTTGGGTCGGCAACTTCGATCCGGAGCCATTAAAGATATCACCGGC
ATTCCTAC

>Exon-3 294-363 bp
CATCTGTTGAGAGTGCAACTGAAGCAGCAAAGGCAGGTGTCCCTTTGGATCAATTTAGA
GACATCTCTAAA

>Exon-4 364-468 bp
AATTGATTTAGCATTCGATGATGCGGATGTTGTAGAACAAGAGTCACTTTCGGCGGTCA
TTGGGCGTCAGCAAATGCACGGTGGTGAGTCAATAATTGAAGAAAAG

>Exon-5 469-564 bp
GAGCATACTGAGAGCAGCTGGGAAGCTGGTCCTCATTGTTAAACCACAGCAATACCAGAGT
GCTGTAGATGGATCGATTCCAGTTCTAATTAAATCT

>Exon-6 565-621 bp
TATTAATTGGTTGGAAACTGCTGAAGAAATAGACGACCTGTTTCTTGGTGATGCTGAG

>Exon-7 622-641 bp
GGTTGGGAGAAGATCATCGTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: