MgSTS67

Genetic marker
Map(s): Not Mapped
Forward primer: AAGTGTTTCTCCGGGAGCTT
Reverse primer: GCTAGCTCACCAGCATCTCC
Tm: 0.0
Physical marker
Overgo sequence fw: AGCTTTTCGAGGAGTGGATTGGAG
                ||||||||
Overgo sequence rv:                 CTAACCTCACCTTTGACCTCTCCT
Tm: 65.4
Set: D / D2
Pools: 2,7,11 / 3,8,14
View Map
Sequence
Unigene: MgU926 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 115-392 bp
ATGGCGCCTGTTTTGAGTAGAAGCTTGGCCTCTGCTGCGGTGGCTGCCGTCCCTTACACGG
CGTCGTTTTCTATTAAGAACACTGGTAAGAGCAGTAGGGGTTTTCTGAGGAGCGCTTTTT
TACCTAGAAATGGATTGAAGAACAGCTTTTCGAGGAGTGGATTGGAGTGGAAACTGGAG
AGGA
GGCAGAGCAGTGTCGTCGTCAGATGCGAGGCGGCCGCCGTGGCTGAGAAGGAGGC
TCCTCAAGCCGATGGTGAAACCTACGAGTACCAGGCGGAG

>Exon-2 393-466 bp
GGTGAGTCGATTGATGGACTTAATTGTCCACAGTTTGTACAGCCACAAGGAAGTGTTTCT
CCGGGAGCTT
GTGAG

>Exon-3 467-592 bp
GTAACGCAAGCGATGCTCTTGATAAGTTGAGGTTTCTAAGTGTTACCGAACCTGCATTACT
TGGAGATGCTGGTGAGCTAGCGATTCGTATCANATCCGATCCCGATAATGGAACCATT
ACTATAAC

>Exon-4 593-643 bp
CGGATAGTGGTATCGGAATGACATAAGAGGAGCTTATAGACTGTCTTGGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: