MgSTS662

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)6 45.24cM

Forward primer: CATTGAGCCACATTTGACG
Reverse primer: TATGCAGGCATGGGAAGG
Tm: 58.6
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU3414 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 5): >Exon-1 88-176 bp
GTCAAGCATCATCAGTATCACTGCCTCCAACATGAGCTTCTTCATTGTTCATCCAATAATT
GATTCCATCAGGCCCAGAAATCTTAACTC

>Exon-2 177-232 bp
CGCTCGAGAACGGATTTCCCTTCCTTGTACTTTTGACTCTTTTCATGAGCAGTTTCG

>Exon-3 233-341 bp
GTATTTCCATCCGACCATTGAGCCACATTTGACGCAGAATATATNCCGCCACTGTGTGT
GATCCGGTCATCATCATCCTCTCTTCTTTATNCCCCGAGAGTTACATTCAC

>Exon-4 342-385 bp
CTCTTCTTGAAGAGATAAGCCTTCCCATGCCTGCATAGGAATGAC

>Exon-5 386-480 bp
CTTGGAAACGACGTCGTCGCTGAGAGCGAGATGAGTCTGGCAATGCTTGCAACTGTAGATC
TTGCCTTCGAGAGCTAACACGAATACCCTTCCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: