MgSTS658

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)12 3.70cM

Forward primer: TTTCCACGATTGCTTTGTCC
Reverse primer: AAAACCGACCCATCACACC
Tm: 61.0
Physical marker
Overgo sequence fw: CACGCAATGCAGCCTTAATCCTCC
                ||||||||
Overgo sequence rv:                 TTAGGAGGCCAATGTAAAGGTGCT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC307
MG__Bb068G15
MG__Bb060K08
MG__Bb077L21
MG__Bb022L04
MG__Bb002C19
MG__Bb069O06
MG__Bb074O21
MG__Bb084D03
MG__Bb046F20
MG__Bb081J22
MG__Bb009D12
Set: C2
Pools: 2,10,14
View Map
Sequence
Unigene: MgU4104 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 358-494 bp
TTAACCCTAGACTACTACAAATCCACATGCCCAACAATTCTCGAAATCGTTCGGAAAGAAA
TGGAATGTGCAGTGCTGTCTGATCCACGCAATGCAGCCTTAATCCTCCGGTTACATTT
CCACGA
TTGCTTTGTCCAG

>Exon-2 495-777 bp
GGTCATCTTCTTCGTAAAATATAGTTCGTATAATTTTTGTGCGTATTATAAATTTTTTAGG
TTTTCTTTTAATACGAATGTAATGGATGCAGGGGTGTGATGGGTCGGTTTTGCCAGAC
GATACGATCACACTTCGAGGAGAGAAAAAGGCGCCTAATAACAGAAATGCCCTTAAAGGA
TTTAGAATAGTCGACAGGATCAAGAACAGGCTCGAATCCGAGTGCCCTGGAATAGTTTCT
TGTGCCGATATTCTCACCGTTGCTGCTAGAGATGCTGGTCTTCTC

>Exon-3 778-782 bp
CGTAAA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: