MgSTS654

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62_x_DUN RILs(2009)4 65.13cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)4 57.04cM

Forward primer: GCTACGATAACGGATTCTTTGC
Reverse primer: AACAGGATCCCGATTCTTCC
Tm: 60.1
Physical marker
Overgo sequence fw: ATCCCATGCTGCTGCTGCTCAGCG
                ||||||||
Overgo sequence rv:                 CGAGTCGCTATAGCGGTCTTTATA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC302
MG__Bb095A09
MG__Ba020D11
MgFPC3021
MG__Bb078C05
MG__Bb086E02
Set: C
Pools: 2,8,13
View Map
Sequence
Unigene: MgU4064 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 86-98 bp
GGCCGTGAAGTAGT

>Exon-2 99-351 bp
TGAAAGATTTTGCGGATTATGCAGAGTTCTGTTTCAAGACATTTGGGGACAGAGTAAAGAA
TTGGCAGACGTTCAACGAGCCGAGAGTGGTGGCTGCACTTGGCTACGATAACGGATTCT
TTGC
CCCTGGGAGATGCTCTAAAGCATTCGGAAATTGCACGGAGGGAGATTCCTCCACT
GAGCCTTACACTGTTGCTCACAATCTCATTCTATCCCATGCTGCTGCTGCTCAGCGATA
TCGCCAGAAATAT
CAG

>Exon-3 352-467 bp
GAAGAAGCAGAAGGGAAGAATCGGGATCCTGTTGGATTTTGTTTGGTATGAGCCTCTTA
CAAAATCCAAAGCAGACAACTATGCTGCTCAAAGGGCAAGAGACTTTCACATTGGATG

>Exon-4 468-687 bp
GGTTCATGCATCCTCTGGTGTACGGAGAGTACCCAAAAACAATGCAGAATATAGTTGGGAA
AAGGCTACCAAAGTTCACAAAAGACGAGGTCAAGATGGTCAAAGGATCGTTCGATTTTGT
GGGCATAAACCAGTACACTGCATACTACATCCATGATGCTAAACAAGACCATCCCAAGAA
CTTGGGCTACCAGCAAAGATTGGAACTCTGGGATTTGCTT

>Exon-5 688-719 bp
TACGATCGTCATGGAGTGCCAATCGGACCACGA

>Exon-6 720-793 bp
AGCACACTCGTATTGGCTCAACATTGGGCCTTGGGGCCTATACAAAGCCGTCACCTACCTG
AAAGAGCACTACCG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: