MgSTS653

Genetic marker
Map(s): Not Mapped
Forward primer: GCAGGAGCCTTTTTCTTTCC
Reverse primer: ACTTCTCCCACTTGCATTCC
Tm: 60.3
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU4060 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 174-260 bp
ATGGGAGTTGAGAAGGAATTGTTGAGGAGCGGCACCGCCCGGAAGCCCGTCGTCGGTCAAA
AAGTCACCGTTCACTGCACCGGCTTCG

>Exon-2 261-294 bp
GGTAAAAATGGCGATCTTTCCCAAAAGTTCTGGAG

>Exon-3 295-356 bp
GCACGAAGGATCCAGGGCAGGAGCCTTTTTCTTTCCAAGTTGGAATGGGCAAAGTTATT
AAAG

>Exon-4 357-409 bp
GGATGGGATGAAGGGGTTTTAGGAATGCAAGTGGGAGAAGTTGCTCGATTAACA

>Exon-5 410-510 bp
ATGCTCGCCCGACTATGCATACGGCACGGGCGGTTTTCCAGCATGGGGTATTAAGCCAAAC
TCGGTTCTGGTTTTCGAGATCGAAGTTCTGAGTGCTCAGTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: