MgSTS652

Genetic marker
Map(s): Not Mapped
Forward primer: TGCCATTGGTCCTCAACC
Reverse primer: AGCTTTTGACCATTTTGAGC
Tm: 60.5
Physical marker
Overgo sequence fw: CCGAGCCAATTCCTCAACCGATAT
                ||||||||
Overgo sequence rv:                 TGGCTATAATGAGCCAATGGGAGA
Tm: 65.4
Set: C
Pools: 2,8,12
View Map
Sequence
Unigene: MgU4033 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 325-454 bp
TCTGTCTCATGTTTGAGCTCCGTAGCGTCAAACCATGTAAGAATTTGGTATAGCCCAATAA
ACTGAGTTTGCCATTGGTCCTCAACCAATCTCTGAGCATAAAATGAGCAGTTGTCCCC
ACATTCAACTCC

>Exon-2 455-622 bp
CCGAGCCAATTCCTCAACCGATATTACTCGGTTACCCTCT
TGCTCAAAATGGTCAAAAG
CT
GTGGATGCAATTTGCTCCCAATTTTCATGAGCCTCCAATTGATAAGTGCTAATTGCA
GCTGCGCAGAACTCTTCAAAGTCCATTTTTCTATAAGATAATGGTGCCATC

>Exon-3 623-685 bp
CGCATGTAGAATATCGGGGACCCTAGACACCTTCATAGCATCAGTAGCATTCCTCGCAAGG
GCC

>Exon-4 686-792 bp
CTTTCTGAAGTGCTCGAGAGAGACTCGTCCATCCTCGCTAGGTTCCAGAAGCATGAATTGA
GCTCTAAGAAAACCAAATCATCCTCACTCACAGCTTTTGAAAGAGCC

>Exon-5 793-809 bp
CTTTAGTGCTGCGCGTTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: