MgSTS651

Genetic marker
Map(s): Not Mapped
Forward primer: GAAGTTGGAAGGTGGATTGC
Reverse primer: TGTCCCCTTATCGAATCAGC
Tm: 59.5
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU4007 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 88-169 bp
AAATTAGCCAATCATGCTATCAAGCTTGGTGGTATTGGATTTGGTACTTCTTTTCTCAAAT
GGGTTGCTTCTTTTGCTGCAAT

>Exon-2 170-277 bp
TTTACTTGTTGATCTTGGACCGTACGAACTGGAAAACGAAAATACTCACATCGCTCTTGAT
CCCGTACATTTTCCTTACTCTACCCTCGTGGTTATTCAACATCTTGAG

>Exon-3 278-348 bp
GGGGAGAAGTTGGAAGGTGGATTGCGTTCGTCGCTGTCGTACTACGTCTTTTCATCCCT
AAACATTTTCCAG

>Exon-4 349-601 bp
GATTGGTTGGAAATGCCGGGATCTTTGATCCTTCTCCTAGTGGTGTCACCTGGATTCTTT
GCTGATTCGATAAGGGGACA
CATAGTCGGAACATTTGTCTGCCTTGTCATAGGTTGTTA
TTTGCTGCAAGAACATATTCGAGCTTCTGGAGGGTTCCGGAATTCATTCACAAGGGCTAA
CGGCATTTCCAACTCTGTTGGGATCCTCCTTCTCTTCGTCTATCCAGTTTGGGCGCTCGT
ACTTACCCTTCTTTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: