MgSTS65

Genetic marker
Map(s): Not Mapped
Forward primer: GCCATTACTGCAGCTGGAAC
Reverse primer: GCATCTAATGCCGCCATAC
Tm: 0.0
Physical marker
Overgo sequence fw: CCGATCTCTTGAAGGTAATGTTCT
                ||||||||
Overgo sequence rv:                 TTACAAGACGTAGATTACGGCGGT
Tm: 64.4
Set: D
Pools: 2,6,14
View Map
Sequence
Unigene: MgU910 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 123-194 bp
CTCAATCACTCTTACCCTCTTGAGAACCGATCTCTTGAAGGTAATGTTCTGCATCTAAT
GCCGCCA
TACATCC

>Exon-2 195-578 bp
CAGTTCCAGCTGCAGTAATGGCCTGCCTGTATTTCTTATCCTGAACATCACCGGCAGCG
AAAACTCCCTTCACACTCGTCAAAGTCGTACCGGGCTTCGTCACCACGTACCCATCGGAA
TCCAATTCCAATTGCCCGTCGAGAAACTTGGTAGCAGGTTCATGCCCAATTGCGAAAAAC
AAACCAGAAACATTCAAATCTGAAATTTCCCCAGTCTTCAGATTTTCGATCTTCAATCCA
GACAACGATCGCTCGCCATATGCTTCTGTGGCCTTCGAATTCCACAGGACTTCAATTTTA
GGGTTTGAAAGAGCTCTGCTCTGCATAATTTTCGAAGCCCTAAATTCGCCCCTGCGGCGA
CTAATGCGGACCTTCGATCCGCACTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: