MgSTS64

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)2 78.67cM

Forward primer: CGGGTTCACCTGACTGATCT
Reverse primer: CTGTGCGAGTGGCTCATAGA
Tm: 0.0
Physical marker
Overgo sequence fw: CGGCTCGTTCAACTGCAAACACAT
                ||||||||
Overgo sequence rv:                 TTTGTGTAGAAGCGTTCGCATTCA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC225
MG__Ba049O04
MlFPC159
ML__Ba037B21
ML__Ba010C08
ML__Ba032K08
ML__Ba060J09
ML__Ba050F21
MlFPC1640
ML__Ba066D05
MlFPC713
ML__Ba081P05
MlFPC805
ML__Ba069J24
Set: D
Pools: 2,6,13
View Map
Sequence
Unigene: MgU902 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 22-271 bp
TAATTACTTCCCTCAAAACTTTTGCAGCATCCTCTGGTAAAACGGGGTTTATGTAGCACCC
CGTTGCTAACTCGAACCCACCTACGGTTGTGAGTTGAGGAACTATCTGTATAAACCAGTG
AGTGAAAGGTAATTGTGTCGAGTCAATCCGAAGTGGAGCGCTGTGAATCATTAAATTGTA
AGGCGGCTCGTTCAACTGCAAACACATCTTCGCAAGCGTAAGTTTCAACAATCCCCCA
AGATCCACTGCC

>Exon-2 272-562 bp
CTTATCATTATCGAGGTCGTGAAAATGAGAAGAGTGATCACGCGGGATTATCCATATCTCA
AAAGGATAAGTGGCGGCAAAAGGTACGACGGATATAAAATGGCTCGACTGATCAATTAAC
AGATCGTCTTTTCTAACTTGGCAGACGCCGCATTTCCCTGTTTGCGCGAAATATTCCTTC
GTACTATCGATTCTTGCAGAAGCGGTGGGTGGAATAATCGGAAGTGCCATAATTTGACT
GTGCGAGTGGCTCATAGA
TGCTCCGGCCGAGGCACCGTGGTTTTTGAATACC

>Exon-3 563-711 bp
CTGAACATATTTAACGGAATCAATGGCGCGGAGCTGGCCGATCCTCTTCTTATAAGTGAGC
AGAACGTCGGCCAATTGCGGCGGGGAAAGATCAGTCAGGTGAACCCGGTGGGCCGGCG
AATCGATCACCACATTGTGGAACCCGAACCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: