MgSTS635

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)8 99.42cM

Forward primer: TGGGTAGATGTGCCTATGTGG
Reverse primer: TAGCAGTGGAAATGCTGTCG
Tm: 60.8
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU3733 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 312-488 bp
ACGCGTCAATTCTCTCGAAGAAGTACAAGTACCCCATGTCGAGTGGTGGATTCTTGGAAAC
ACCAACTTTATCGTCATTGAAAATCACCCACCTACCGTTTTTGTAGATATGTGCAACATA
ATGCCCACAGTGGGTAGATGTGCCTATGTGGCTCACTAGTCCAATTAGTCGGTATTT

>Exon-2 489-612 bp
TTCCTTGTCCATCAGGTAGAGCTGCATCGACAGCATTTCCACTGCTACTAGGTGTAGTA
TCCATATTTGACACACCAGAAGGAGGATTAAATATCCATTCCGTAGCTTTTTCAATATCA
CCATCC

>Exon-3 613-734 bp
CGATGCCTGAAGAGCCTTCCGAGCAGTATCTTCGTCAAAGCCAAATGATATTAAAGTTTCG
AGTTTTGATGGATCAATGAATGAAGCACTCTTCTGTGCTTTTGCAATAGGTTCATCAATG
TC

>Exon-4 735-809 bp
CTGGATCATTCATATGGTTAAGTAGCCAATTCATCGCTTCTTCGAGTCCAACATTTGATGT
ACTGATGGCAGCCTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: