MgSTS63

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 1.82cM
M. guttatus IM62_x_DUN RILs(2009)11 75.02cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)11 59.34cM

Forward primer: AACCATCCGCAAAGGAGTAA
Reverse primer: TTTGGACGTCTTTGTTGAGC
Tm: 0.0
Physical marker
Overgo sequence fw: GGGAAGCTTCCCAAAGCCGTTGCT
                ||||||||
Overgo sequence rv:                 GGCAACGAACTAAGGGTTAAAGGA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MlFPC970
ML__Ba073I08
Set: D
Pools: 2,6,12
View Map
Sequence
Unigene: MgU890 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 271-339 bp
CTTTCCGGGAAGCTTCCCAAAGCCGTTGCTTGATTCCCAATTTCCTAATCTCCATTAGA
CCTTGCTCAAC

>Exon-2 340-466 bp
CATCGACTGCGTCATGCGAAGTTGGTGACTGGCCGCTGCGGCCGATCCAGAATTTCAGTCT
CTCGTTTGCAATTTCCTCTTCTATACCGTAAGCTTTAGCTCTTCTCCAAAAGTACATAAG
CCATGCC

>Exon-3 467-507 bp
CTCCTTAAACAGGACATCCTCAGATTCCTCTGGGCTAAGTTC

>Exon-4 508-549 bp
CAAATGCTTCCATATACTTCGGATCAATTGGTGATTTGAAGTC

>Exon-5 550-619 bp
CTGGCATGGATGTCCTTGAAGAATTTGGACGTCTTTGTTGAGCANATGCCAGAACCATA
GATTCTTCAACC

>Exon-6 620-735 bp
CTTCAAGGAAGCTAGTTCTTTTAAGCCCATTTCAACTGTTAGCATGCTCTCAATATTTCCG
TCTCCAGTAAGATCATTAAAGTCGTCAACAAGTTTACTCCTTTGCGGATGGTTNTC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: