MgSTS62

Genetic marker
Map(s): Not Mapped
Forward primer: ACGCCTTTGAAGGGACTTCT
Reverse primer: GTTTTCCGCCATGTTCCTAA
Tm: 0.0
Physical marker
Overgo sequence fw: CGGTGGCTGCTCTCCAGTATTTGA
                ||||||||
Overgo sequence rv:                 CATAAACTAACTGATGCACGTAAC
Tm: 65.4
Set: D / D2
Pools: 2,6,11 / 3,8,12
View Map
Sequence
Unigene: MgU888 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 28-211 bp
TCTGAAAATATCGAGATTATGACTGATATGGCGGAAGTGTTTGGGGATAAAGTGGTTGAGG
TGGCTTCTTCGCAGGTGGGCCCGGTGGCGAATGAGGTGGCGCTTGCGGCGGCAGATTCTT
TCATGCCGGTGGCTGCTCTCCAGTATTTGATTGACTACGTGCATTGTTACACTGGGTT
TAATTG

>Exon-2 212-302 bp
GGTGGGCATCGATTGTTGTGACGACGATTTTGATTCGTTGGATTCAACTTCCTCTTATGAT
AAATACGCTGAAGTCAACTTCAAAATTCACT

>Exon-3 303-350 bp
TCTTCTAAGGCCTCGTTTGGAGGAGATTAAGGAAGACATGCAAAGTAGG

>Exon-4 351-409 bp
GGATATGAGTCCTGCTGCTGTAGCCGAAGGACAAGAACGAATGAAAAAGCTCTTTAAGGA

>Exon-5 410-485 bp
AATACGGTGTTACACCACTAACGCCTTTGAAGGGACTTCTAATCACTGGTCCGATCTTT
TTTTGCTTCTTCTTAGCT

>Exon-6 486-617 bp
TGTTAGGAACATGGCGGAAAACGTTCCGTCTTTTAAAGAGGGAGGTGCGTTTTGGTTCA
CCGATTTGACTACTCCCGATACCATGTACATTTTCCCGATTCTGACGGCATTAACATTTT
GGATTACGGTTGAG

>Exon-7 618-725 bp
GTGCAATACTCAGGACGGTATGGAAGGCAACCCGACAGCTGGCACTATCAAGAACGTCTCT
CGGGTCTTTGCCGTATTGACTGTCCCTTTCACTGCANTGTTCCCGAAA

>Exon-8 726-748 bp
AGCTATATTCTGTTACTGGATTCC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: