MgSTS61

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 107.58cM

Forward primer: GACCCCACGGACGTACTAAA
Reverse primer: AGCAGCAGTGATTCCCACTT
Tm: 0.0
Physical marker
Overgo sequence fw: TTTGCAAGCGGAGCAATTTCGTCG
                ||||||||
Overgo sequence rv:                 AAAGCAGCGGAAGTTATGGCCCAA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC261
MG__Ba021J21
MG__Ba017D13
MG__Bb095A14
MG__Bb034J04
MG__Bb088K07
MG__Bb033J22
Set: D
Pools: 1,10,15
View Map
Sequence
Unigene: MgU880 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 212-329 bp
TTCAAGGAGTAGCGACATTTTCCTTTGCAAGCGGAGCAATTTCGTCGCCTTCAATACCGG
GTT
CGCTGCCTGCCACCCCCAAGCTTAGCAGCAGTGATTCCCACTTCTTTGCCGGTC
CC

>Exon-2 330-458 bp
CTTCCACGAGAGATCTTGCGACATGCAATTTTGAATCATTTCTTCGAAGGCAACGGTACCG
TACGCCGCGAGAGCTCTTTCAACGGTTGTGGCTATTTTTAGTACGTCCGTGGGGTCCA
CAGTGGCGCAC

>Exon-3 459-652 bp
CTCGACATTAAAATCTCCCATGTGGAACCCCGTATATCCATCTTTCACCGTGTCAACCAGA
CCACCGGTCGAAGCACAGATCGGTATCGTTCCGTATCGCATGGCATGTAATTGGATGAGA
CCGCAAGGTTCANATCGACTTGGAACTAACATAAAATCGGCACCAGCAGTTATCATGTGA
GCCAACGGTACATT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: