MgSTS60

Genetic marker
Map(s): Not Mapped
Forward primer: CTCTATGGCCGATGCAAAAA
Reverse primer: CGAGCTCCTTCATCTGCTCT
Tm: 0.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU867 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 61-250 bp
CCCCACGAGGCCGACTCCTCATGATTGTTTCGTCGCTGTGTCTGATAAATTCGGAAAGTTT
CCAAGGCTTTTGCCACTTCCATTTGAACTGTAATAGCCATTGATGATGACTCCTCTTCCA
TCTCCATAGCTTCCCTCCTTGTCCGACCATCGCTAATTTCTTCATCGACAGCTGTCCAAT
CGGAACCATC

>Exon-2 251-412 bp
CTTGCGTGTTTGATCGATAAATGCAGCGGAATCTCTCCCCGAGCCGTTAGCTATTCCGGCT
GTATATTTGAGCTGTTTTTGTGCGGGCACGGGAATCGGAGATAATGGCCCGCTCATGTCG
TCAGCTACGTGTCTAAGTGAATTTCCAGATGGTGGTGTAGAA

>Exon-3 413-560 bp
AAATGCGGTAGCGAGAGCTTGCTCTCTTGATCTTAGCTCCTTCTCGATTTCCTTTCTTCGA
ACTTCACTTTGTCTCAATAAACCAACGAGCTCCTTCATCTGCTCTTTCATCTCTTTTA
TTTCCATTTCCCTTTCCCATAACTGACACC

>Exon-4 561-642 bp
CTGTCATCACCGAGATAATTGAACATATATTGAAGAAGATTTTTTGCATCGGCCATAGAG
CGAAGTTGGTTCCATCTTCCACG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: