MgSTS59

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)8 42.10cM
M. guttatus Irn Mtn Combined(2009)8 34.93cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)8 29.19cM

Forward primer: TTTCCGATTGGAGATTCGAC
Reverse primer: ACTCCAGGAACGTTTGGATG
Tm: 0.0
Physical marker
Overgo sequence fw: GCGATCGGATTAATGGCTTGCTTG
                ||||||||
Overgo sequence rv:                 GAACGAACTACCGTAAAGGCCGTT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC232
MG__Bb001M20
MG__Bb039G20
MG__Bb061G02
MG__Ba060C18
MG__Bb073A11
MG__Bb076B18
MG__Ba022D19
MgFPC260
MG__Bb041H17
MgFPC394
MG__Bb030M08
MG__Ba019C10
MgFPC542
MG__Bb077O17
Set: A / D2
Pools: 2,7,12 / 3,7,15
View Map
Sequence
Unigene: MgU832 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 152-476 bp
GCGGCCGCCGGCGTGGCCGAGCCGGCAAGAGCCGAGCCGCCGTCTAAGGAAAATAAGAAGA
TGAGGGTTTTGGTGGCCGGCGGCGGAATTGGGGGGCTGGTTTTCGCTTTGGCGGCGAAGA
GGAGAGGGTTTGACGTGGTGGTGTTTGAGAAGGATTTGAGTGCAATTAGAGGGGAGGGGC
AATACAGGGGGCCGATTCAGATACAGAGCAACGCATTGGCTGCTTTGGAAGCCATTGATA
TGGATGTTGCTGATGAGGTTTTGAGCTCCGGTTGTATCACCGGCGATCGGATTAATGGC
TTGCTTGATGGCATTTCCGGCAA
TTG

>Exon-2 477-629 bp
GCTACGTGAAGTTCGATACTCTCACCCCTGCAGCACAACGAGGACTTCCACTTACTACAGC
CATTAGCCCAATGACTTTACAACAAATCCTAGCTCGCGCAGCCGGCTCCGACATTATTAT
TAATGATACCAACGGCTCTGATCTTAATGACGA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: