MgSTS58

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)6 77.20cM
M. guttatus Irn Mtn Combined(2009)6 38.54cM
M. guttatus Irn Mtn Combined(2009)10 104.17cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)6 42.12cM

Forward primer: TCAATCAGGGATGAGGAAGC
Reverse primer: ATGGTGTCGTTTGCCTTGAT
Tm: 0.0
Physical marker
Overgo sequence fw: CCCTTCTTTCCGAACTGAACTGAG
                ||||||||
Overgo sequence rv:                 CTTGACTCGCCTGAAACGTATCGA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2547
MG__Bb088G06
MG__Bb089H13
MgFPC33
MG__Bb015P07
MG__Bb033B07
MG__Bb072M12
MG__Bb033A12
MlFPC1224
ML__Ba058I21
ML__Ba032G06
ML__Ba044C21
ML__Ba051K05
ML__Ba034F21
ML__Ba002I19
ML__Ba038K05
ML__Ba004C14
MlFPC1472
ML__Ba021H11
MlFPC152
ML__Ba088N22
ML__Ba006F11
ML__Ba092J23
MlFPC261
ML__Ba061I03
MlFPC410
ML__Ba018B16
MlFPC696
ML__Ba072J15
Set: A
Pools: 2,7,11
View Map
Sequence
Unigene: MgU768 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 227-653 bp
CAGTTGCCGATTGGGCAGCGAGCCTCTTCCTGGCCTCCTCAATGATAGTAAACTTAATACC
TTTGCCCTTTGGAAGAGAAACCCACGGCTTTGTACCCTTTCCAATGGTGTACACGTTGCT
CAATCGTGTAGCAAATTCATTGCCAGTTGAATCCTGAATGTGAACAGTCTCAAAGCTACC
CTTATGCTTCTCACGATTCTTGAGTATTCCAACACGGCCTCTGTTCCTACCACCAGTCAC
CATCACAACATTTCCGACATCGAATTTGATAAAGTCGACAATCTTGTTGCTGTCCAAATC
CAGCTTGATGGTGTCGTTTGCCTTGATAAGTGGGTCCGGGTAGCGAATGGTCCTTCCA
TCGTATGTGTTGATGTACGGAATACCCTTCTTTCCGAACTGAACTGAGCGGACTTTGCA
TAGCT
TAAAC

>Exon-2 654-697 bp
CTTGGCTTCCTCATCCCTGATTGAGTGTAGCCTGAACCTTCCCTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: