MgSTS57

Genetic marker
Map(s): Not Mapped
Forward primer: GGTGAACTACCTTCCGGTTG
Reverse primer: TTAGACCGGGGAGAACCTTT
Tm: 0.0
Physical marker
Overgo sequence fw: TTGAGGTTTGTCTGGGAGAGGTTT
                ||||||||
Overgo sequence rv:                 TCTCCAAAGAACAACGTAGCGGAC
Tm: 65.4
Set: B / C
Pools: 1,6,15 / 5,6,13
View Map
Sequence
Unigene: MgU94 (Build 6)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 49-1007 bp
AACATACTTCCTTAGCTGCAGCTATAACAGCTTCGGCCGTAATACCGTACTCCTTGTATAT
CTTCCCTGCAGGTGCACTCGCTCCAAATTTATCAATCCCGATCGCCTTTCCTTTACTCCC
AACAATCTTATGCCACCCGAAAGTTGTTCCAGCCTCAATGCTAACCCTAGCTGTCACAGC
ACTCGGCAGCACACTTTCCTTGTACTCGGCTGACTGATCCTCGAACAACTCCCAAGAAAC
AAACGACACCACTCTCACTTTCTTGCCTTCCTTTCTCAGTTCATCCGCAGCTTTAGCTGC
AATCTCCAACTCagaGCCAGTTCCAATCAAGATAACATCCGGCTTGTTGTCCGAAGAATT
GTCTGAAATGGTGTAGCCCCCCTTTTCGACCCCCTCGATTGAAGTTCCAGCCAGATTGGG
CAGCTTCTGACGAGAGAGTGCAAGAACTGAGGGTCGTTTTCTGTTGTCAACGGCAACTTT
GTAACAGCCAGCTGTCTCGTTTCCATCGGCCGGGCGGAGCATGAGGATGTTGGGCATTGC
CCTGAAACTGGCCAAGTGTTCGATAGGCTGATGGGTGGGCCCATCTTCACCGAGCCCGAT
TGAGTCGTGGGTCATAACATAGATGACTCCTGCTTCGCTGAGGGCTGAGATTCTCATGGC
TGATCTCATGTAGTCTGTAAAGACGAAGAAGGTTGCACAGTAAGGAATGAAGCCCGGGCT
GTGGAGGGCAATTCCGTTGCATATGGCTCCCATGCTGTGCTCACGGACACCGAAGCGAAC
GTTTCGCTCTTCGGGTGTTTTCTTTTGGTAGTCGCCGAACATTTTCAAGAGGGTCATGTT
GGATGAGGCGAGATCTGCACTGCCTCCAATTAGACCGGGGAGAACCTTTGCGAGTGCG
TTGAGGTTTGTCTGGGAGAGGTTTCTTGTTGCATCGCCTGGGNGTTTCGGGTGTGTAT
TTG

>Exon-2 1008-1081 bp
GGGAAGAGCCTTTTCCCAACCGGAAGGTAGTTCACCGGTGATGATTGATTTCAGCTCAG
CTGCTTCCTCTGGGTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: