MgSTS56

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 82.70cM

Forward primer: GGACTGATGCCAAACCCTAA
Reverse primer: AATCTGCCTTCCCAAAAGGT
Tm: 0.0
Physical marker
Overgo sequence fw: ACACCTTTTGCCCCCGATGGCTTG
                ||||||||
Overgo sequence rv:                 TACCGAACAAGCTCAGATGACTAA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2312
MG__Ba025E21
MgFPC290
MG__Bb094H10
MG__Bb094E07
MG__Bb012P06
MG__Ba023D02
Set: A
Pools: 2,6,15
View Map
Sequence
Unigene: MgU520 (Build 2)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 238-361 bp
AAAGCTTGTAATCAAGCATATCTCTAATGTTTAACCGAATCGACGGCCCCATTGAAGAGCA
TATATGCGCACTTTTCCAGTACACACCTTTTGCCCCCGATGGCTTGTTCGAGTCTACTG
ATT
TC

>Exon-2 362-487 bp
CACAGCAGCAAGAAAGTTAATCATAAGATCTTCCTCTGAAAAATCTGCCTTCCCAAAAGG
T
AAGTGAACAATCCCGGTTTTATCAGCTCTGAATTCGACTTTCCCTTTCTTGAATTCCG
CTATAGCC

>Exon-3 488-571 bp
CTGTGGTATGTTCGTAGTCACTGTACCAGCTTTAGGGTTTGGCATCAGTCCTCTCGGTC
CAAGAATTTTTCCTAGACTTGCAACC

>Exon-4 572-699 bp
CTTAGGCATCATATCCGGTGTAGCAATTAATTTATCGAAATCCATAAATCCTCCTTTTATC
TGTTCTATCAAATCCTCTCCACCAACTATATCTGCTCCTGCAGTTTTCGCCTCGTCGAAC
TTTTCACC

>Exon-5 700-754 bp
CTTGCGTAAGAACAGCAACTTTAATAGTTTGACCAGTTCCCTTGGGAAGATTTACA

>Exon-6 755-934 bp
AGTTGCCCTCAGTTGTTGATCGTTATACTTCGGGTCAATGTTGAGGCGGAAATGCGCTTCA
ACCGATTCAACAAACTTCGTGCTTGTGGTTTGCTTGAGCAATGACATTGCTGTTTTCAGG
TCGTACTCCTGTTTGTTTTCTCTCAGGCTTTGAATTTCCAGAAATCTCTTCGACCTTGTT


>Exon-7 935-1078 bp
TCTGTCCCTCTTCAAAGGCAAGGCAGCCTTGCCTTTCTTGGGCTTCGTGGCAACGNGCAAC
ACCGCCGCCGCCGCCAACTTGCTCCTCTTCCACGGCGTCTTCCTCCAGCTCCGCCTCGGC
CAGAGCGGCGGAGACGATTGATTT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: