MgSTS55

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)13 93.00cM
M. guttatus Irn Mtn Combined(2009)13 34.83cM
M. guttatus IM62_x_DUN RILs(2009)13 60.72cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)13 65.61cM

Forward primer: CCTCACTTCCAAGCTCCTCA
Reverse primer: TGTGGACACAGTTTCAGCGTA
Tm: 0.0
Physical marker
Overgo sequence fw: TTCAGTGTGGACACAGTTTCAGCG
                ||||||||
Overgo sequence rv:                 AAAGTCGCATCATGAAGAGGCGGA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC1268
MG__Bb025M16
MgFPC241
MG__Bb088N03
MG__Bb087G04
MG__Bb086J04
MG__Bb053O16
MG__Bb046M11
MG__Bb018K10
MG__Ba032K12
MG__Bb087P07
MG__Bb092C12
MG__Bb079A07
MG__Bb076G20
MgFPC2585
MG__Bb031K11
MG__Bb047D04
MG__Bb072H11
MG__Bb041O11
MgFPC2768
MG__Bb070C22
MgFPC30
MG__Ba026B02
MlFPC1223
ML__Ba020N12
MlFPC1242
ML__Ba018C14
MlFPC494
ML__Ba064C02
MlFPC711
ML__Ba009F21
ML__Ba028A05
ML__Ba093N21
ML__Ba093D04
ML__Ba041N04
Set: A
Pools: 2,6,14
View Map
Sequence
Unigene: MgU462 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 226-325 bp
TCTAACCAAGCTTGGCCAGAACTTCATTCAGTGTGGACACAGTTTCAGCGTAGTACTT
CTCCGCCT
CCGCCGAGCTCTTGATTTTTGCCGCATGGTCCAGA

>Exon-2 326-621 bp
ATCGCTGATGTTCTTGAGGAGCTTGGAAGTGAGGTCTTTAAGAGATTGCTTTTCTGCCT
TGGGCTTGGCAGCGATAACGGTGTTAAGATCGTAACGGAGGTAGGATGCCTTTGAACGGA
GATCGTTTTGCACGTAAGGCCACGCCTTCTGTTCGATTAGCGTTTTCACCCCCACAATTT
CTTTAGCAGACTCTTTAGCCCTTGCTGCTGCCTCAATGGGTGTTTTTGGCTGAAGATAAA
ACCTCTCTTTTAGGGGCAATTTGAAGTCTCTTGCTTCGTCCGAGTTCAATGTTCCAGG

>Exon-3 622-900 bp
GCAGTCCACCGGAGGGTGGGGGTGGTCCTCCGATCTTGATCGGCTTGGCGTCGGCGAGCAC
GGCTTGCACAAAGGATCCTGAGGCGATTCCGGCGGCAACAAGCCCCAACATGGTACGGCG
GCTTGTCTCGGTCTCGGCTGAGCTCTGCTGCTGGGCTCGAATAGTGAAGTACTCTGGTCT
GGACACGGCGATTCTGCCGGGTGTGCTCAAGCGGCTGGATTGGAAGCTCCCTTCCAGGAC
GGCTTGAGAAGAGCCACGTAAGCCAGCCATCGACGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: