MgSTS535

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 4.60cM
M. guttatus Irn Mtn Combined(2009)3 0.00cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 0.00cM

Forward primer: CATGGAAATCATCCACTTGC
Reverse primer: AACACCAGCTGAACCAATCC
Tm: 58.9
Physical marker
Overgo sequence fw: GGCTGTTCGCATCATCAAGCATGC
                ||||||||
Overgo sequence rv:                 TTCGTACGGTACCTTTAGTAGGTG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2768
MG__Bb010D15
MgFPC453
MG__Bb025A22
MG__Bb065B04
MG__Ba024K06
MG__Ba083M24
MG__Bb067A01
MG__Bb064D15
MG__Bb088H13
MG__Bb008K04
MG__Ba048A10
MG__Ba090D16
MG__Bb071M09
MlFPC209
ML__Ba064H20
MlFPC31
ML__Ba033H08
ML__Ba037K22
ML__Ba040J09
ML__Ba076C18
ML__Ba046I24
Set: A
Pools: 5,7,15
View Map
Sequence
Unigene: MgU1221 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 4): >Exon-1 2-125 bp
ATGCACGGCCGTAACAACGGAAAGAAGTTGATGGCTGTTCGCATCATCAAGCATGCCAT
GGAAATCATCCAC
TTGCTAACTGACCAGAACCCAATTCAGGTCATTGTTGATGCTGTC
ATCAACAG

>Exon-2 126-329 bp
GTGGTCCGAGGGAAGATGCAACCAGGATTGGTTCAGCTGGTGTTGTGAGGCGTCAAGCT
GTTGATATCTCACCTCTTCGCCGTGTGAATCAGGCCATTTATCTCATCACAACTGGTGCT
AGGGAATCCTCTTTCAGGAATGTTAAGAGCATTGCTGAATGCCTTGCTGATGAACTCATC
AATGCTGCTAAAGGATCGTCGAACAG

>Exon-3 330-383 bp
GCTACGCGATCAAGAAGAAGGATGAGATCGAGAGGGTTGCCAAGGCTACCCGTTA



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: