MgSTS53

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)12 5.36cM
M. guttatus IM62_x_DUN RILs(2009)12 0.00cM

Forward primer: GATGGCAGCTTGCTAAAAGG
Reverse primer: TTTCTACCGGTCCCACTCAC
Tm: 0.0
Physical marker
Overgo sequence fw: CTTCACGTGACATAACGAGCGTAT
                ||||||||
Overgo sequence rv:                 CTCGCATAGCACGTCGTCTTACGA
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC2135
MG__Bb028I12
MlFPC672
ML__Ba046N10
Set: C / C2
Pools: 5,6,12 / 1,6,12
View Map
Sequence
Unigene: MgU358 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 229-331 bp
ATCAACGACTGATCGGAGTATGCATTCTTTCAACGATTCTGTTCACAGCTTCACGTGACA
TAACGAGCGTATCGTGCAGCAGAATGCT
ATAAACATTCAAACCG

>Exon-2 332-505 bp
GATTGCAGGTAGTACATTGACGTAGTGCACATTTTGAGTAGCCAGCTTCAGCTTTTCATTA
ATCGAACCTCCATCAACAAGCAGAAGTTTCTTAGCATCTTCCATTTGATTCGCGTAGTTC
ACAATGTTCTTCGTCTTATGTGAAGGAACCTCCATATCATCGAAAATCAAAAGC

>Exon-3 506-625 bp
CTTGCCTTCTGCCGCACGAGCTGAAAGTGCAACTTTCAACCCTAGTCGACGAACTTTCTTG
TTTAGCTTGATAGCATGACTTCGTGGCCTTGGACCGTGCATCGCACaACCACCCCTAAAC


>Exon-4 626-733 bp
CTGTGGGCCCCGCagcgttCCGTGCCTTGCTcgaccaGTACCCTTTTGCGGCCAAGGCTT
TCTACCGGTCCCACTCAC
CtCgCTAAGATTTTTGGtCGAATGGGTACCC

>Exon-5 734-882 bp
CTGCTGCCTTttAGCAAGCTGCCATCTTACAACACGGTGAATAATATCCTTCCTAATTG
GGACATCGAAAACATCACCAGCCAATACCATGAACCCCTTGTCCTCGTTGGCAAAATTTG
TAACAGGAATCACCAAATCCTGATAGAGACC

>Exon-6 883-1015 bp
CTATTTCACGCTCTGGAGCCAGCACGTGTTTTGAGGACAATAAATGAGAAGGGAATGCGCC
TTCACTCGAATTTGGGGTCAAAATTGTTGTCGAATATTTCCGGTACNACATCAAACGGCA
CCTTCCCAGGTAC

>Exon-7 1016-1075 bp
CCAAAGACTGCAACGAAGGTAAGCTATCCCCAACACTGCCGTTGAAGTTCAACGCTGCATT


>Exon-8 1076-1153 bp
TACACAAAGAAGCTGGTCCGAACGAAAAATCGGACGATCGAAAAGCACGCAATACCCTTCT
CGAAATCGACAATGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: