MgSTS52

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus Irn Mtn Combined(2009)11 29.04cM

Forward primer: GATTTGGGGCAGAAAGCATA
Reverse primer: TGCTAGCCTCGTAAGCCATT
Tm: 0.0
Physical marker
Overgo sequence fw: No experimental results available
Overgo sequence rv: No experimental results available
Tm:
BAC contig:
Set:
Pools:
Unigene: MgU314 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 150-358 bp
TTCATCTCTGCAGTAAGAGAGCAGCTCCGACAAGACCCATCCACAAAGTTAGAGAAACCCA
GAATGTTCGATTCTTCTCCATCCCGACGGGCGGTTTCCACACCAGAAAATCCCCCAAATA
GTCTTTTGATGATGTCAGCTGATTCGTTGTGGAGCCGCTCATCCTTTCGTCTTTGTCCTT
GTTTTTATCCGTCCAAGTAGCTGCGTAAC

>Exon-2 359-564 bp
CTATCATAACTCGAACCTATTAGTGGGATCGTGACCATCTCTTCCTGCGATATCTTAAGCT
TGGGCGCTTGCAGAATGTAGCGCAGCTCcgagGCTTGCCTTCGAATACTGACACTGGGAT
GCTTCCTTTCCAATTGCTTATAAAGATCAATGCAGTCcGCATGGCGATTGCTAGCCTCG
TAAGCCATT
GCCAGCcATATTTGTATC

>Exon-3 565-717 bp
CTCACCgccnaacAAGGTTGGCCTGGGAATGATTGTGAGTGCACCTTCGAGAAATTCAATG
GCGCGTCCATACATACCCCTTCCGTATGCTTTCtGCCCCAAATCGAaCATCAATTGAG
CGGTttTCCTTCGTTCTGCTtGCTcctatGCTACC

>Exon-4 718-1221 bp
CTtttCtAGttCtttCttaacccTCATGCGCTTCTGttCTTCAGTTTCGTCATCCGGCTGG
CCGTTGCCACCGCCGCCGGCGCCGAACTCCTGATCGACTTTGTAcTGCAATTCTTCGGCT
TTCTTCTCCAACTCCCTCATTTCTTCAATTTCCTTcacTCTCTTCCTCATCTCCCTCTCC
CAGTTGAATTCATCGGCTTCATCTTCGAGCTCATCCTCGAACCCGCTCCCGCTGCCGCCG
TTCTGGTCGTCGCTGGAATTGTCGTACTCCANCTCCGTTCACCTTCGACTGGTTCGATTT
CCGCTTGTTCGAGTGCCTTTCCCGGTTATCGAACACCGATTCGAACGCCGCGTGGAAATT
AGGGTTCTGGTGGAGGTCTTTGTTGAAGAGGTTCAGGAGCGCGTCGGAGGGGAAGGGGCG
GAgGCGGCGGTCGGGGATTATGGGCCGAGGCGGCGAGGTGGAGAGGTCGAGGAACGGAGa
aaCGTTGCCGAGCACTAcCGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: