MgSTS51

Genetic marker
Map(s): Not Mapped
Forward primer: CCTGATGTTGACGGTTTCCT
Reverse primer: TCAGCAGCCTTGATGATGTC
Tm: 0.0
Physical marker
Overgo sequence fw: GTGTCCATGCTTAATGCGGCTGAA
                ||||||||
Overgo sequence rv:                 GCCGACTTCATGGTAGCGTTCTAC
Tm: 65.4
Set: C2
Pools: 1,6,11
View Map
Sequence
Unigene: MgU301 (Build 4)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 73-110 bp
ATGGGCAGAAAATTCTTCGTCGGCGGCAACTGGAAATGC

>Exon-2 111-186 bp
CAATGGGACTAACGACGAAGTGAAGAAGATCGTGTCCATGCTTAATGCGGCTGAAGTACC
ATCGCAAGATG
TTGTCG

>Exon-3 187-310 bp
GAGGTTGTTGTCAGCCCTCCATACGTGTTTCTACCTGTGGTAAAAAGTTCTCTGCGGCCCG
ATTTCCATGTTGCAGCTCAAAATTGTTGGGTTAAGAAGGGTGGTGCTTACACCGGTGAGG
TTAG

>Exon-4 311-395 bp
GTGCTGAGATGCTTGTCAACCTGGACATTCCCTGGGTTATTCTTGGTCACTCCGAAAGAAG
GGCTCTGTTGAATGAATCGAATGAG

>Exon-5 396-528 bp
GTTTGTTGGAGATAAAGTTGCTTATGCACTTGCCCAAGGTTTGAAGGTAATTGCTTGTATT
GGAGAGACTCTTGAACAGAGGGAATCTGGATCAACTGTGGCAGTCGTTGCTGCACAAACC
AAGGCCATCGCAG

>Exon-6 529-623 bp
GAAAAGGTTTCTGATTGGACAAATGTTGTCTTGGCTTACGAACCTGTCTGGGCTATTGGAA
CTGGGAAGGTCGCCAGTCCTGCTCAGGCTCAAGAA

>Exon-7 624-702 bp
AGTACACCTTGAATTGAGGAAATGGCTTGAGACAAATGTAAGCTCTGAAGTTGCTGCTTCA
ACCAGGATTATCTACGGAG

>Exon-8 703-785 bp
GGATCTGTGAATGGTGGCAACTGCAAGGAATTGGGTGGGCAACCTGATGTTGACGGTTTC
CT
AGTTGGCGGTGCTTCTCTTAAG

>Exon-9 786-835 bp
GCCCGAATTCATTGACATCATCAAGGCTGCTGAAGTAAAGAAAAGTGCTTG



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: