MgSTS50

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)3 6.20cM
M. guttatus IM62 x M. nasutus SF F2N2 (2009)3 2.99cM

Forward primer: CCTACGTGACAGAACGTCCA
Reverse primer: TCCTGACCACCTCCAAGAAC
Tm: 0.0
Physical marker
Overgo sequence fw: AATGGTGCAACCTCACATATCCAT
                ||||||||
Overgo sequence rv:                 TATAGGTAGAAGTGGAGGCGAGCT
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC911
MG__Bb061O20
MG__Bb087O20
MG__Ba045O09
MG__Bb063H24
MlFPC29
ML__Ba063C05
MlFPC662
ML__Ba083M12
ML__Ba005G18
ML__Ba006B03
ML__Ba052N04
ML__Ba096G07
Set: A
Pools: 2,6,13
View Map
Sequence
Unigene: MgU231 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 273-349 bp
TTTAAATCTTGATATTGAAGTAATCTTGATCAAAATGGTGCAACCTCACATATCCATCTT
CACCTCCGCTCGA
GAAAC

>Exon-2 350-429 bp
CTTCTTCCATCGGGATTAAATGCCAAGGCGTTTATGGGTCCGAAATGGCCTTTCACACCTC
CAATTTCTTCTGTAAGGATC

>Exon-3 430-516 bp
CTTGTCATAGAATTTTGCCTCAAACTTTCCAGCACGATGATCAGTGGTGGTAACAGATGAT
GCATCCTGACCACCTCCAAGAACCACA

>Exon-4 517-606 bp
ATGATCAAGAAGTGGAGACATTGCAACTGCATTTACTGGACGTTCTGTCACGTaggTCT
TGATaAGTGTCAGTGTCCTTGAATCCCAAAGC

>Exon-5 607-708 bp
CTTGGCAGACTTGTCCAAGGAACCAGTGAgaaaATGTGAAACATCTGTGGCTTTTGAGAGT
GATGtaatanggttttttgtgccCGTcctccttgtcagactC



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: