MgSTS49

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)2 73.10cM

Forward primer: ACATAGCTGCGGATTTGCTT
Reverse primer: CCTCTCCGGCAACTACAAGA
Tm: 0.0
Physical marker
Overgo sequence fw: CAGAACCTGCATTCTCAACGAAAC
                ||||||||
Overgo sequence rv:                 TTGCTTTGAAAGGGTGAAGAGCCG
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC321
MG__Ba045J10
MG__Bb095B07
MG__Ba012N03
MG__Bb095D19
MG__Bb076D18
MG__Ba009I12
Set: A
Pools: 2,6,12
View Map
Sequence
Unigene: MgU226 (Build 4)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 96-462 bp
GATTAGAAAGTTGTCGAGCTTCAATGTCTTTAAGTCTGAGAGTGACAGCTCTCTTGTGGGC
ATCGAGACCTTCAATTTCAGCCATAGTTGCTACGTAAGGACCAAGTTTCCTAAGCCCTTC
TTCTGTCAGTGATTGTACGGTGATGTACTTCAAGAACGAGTCTAACGAGACTCCACTGTA
CATACGTGCGTAACCGTAAGTTGGAAGAACGTGATTCGTCCCACTTGCGTAATCTCCAAC
GCTTTCTGGTGTCCACTCACCCAAAAATACAGAACCTGCATTCTCAACGAAACTTTCCC
ACTTCTCGGC
ATCTTTGACATTGATTATTAAGTGCTCCGGTGCATACAAGTTAGAAAAA
GCAATAGCC

>Exon-2 463-633 bp
CTCAACCATATCGCGTGCGTGAACAATAAAGCTgTGACTTagtGCTTTagaAGCAAAGGCT
CCCCGAGGAAggCTATTGCATTgttTgTCAATTTCGTccTCaATTGcagttACATccacA
CCCtctccggCaacTacaagaacAACTTggctatcagggccATGCTcagcc

>Exon-3 634-698 bp
ctgtgAAAGCAAATccgcagctatgtgaacagggctggtatgtttatcagcaatgacaa
gaacttc



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: