MgSTS48

Genetic marker
Map(s):
Map SetLinkage GroupPosition
M. guttatus IM62 x M. nasutus SF F2N1 (2006)10 77.60cM

Forward primer: TCCTGGAGTACCTGGTTTCG
Reverse primer: TGAAAGTGGTGCAAATCTGG
Tm: 0.0
Physical marker
Overgo sequence fw: TGAAATCAGCGTCGCCGTGAAAGT
                ||||||||
Overgo sequence rv:                 CACTTTCACCACGTTTAGACCTAC
Tm: 65.4
Contig BAC
BAC contig and clones containing marker:
MgFPC42
MG__Bb027I15
MG__Bb025M02
Set: A / D2
Pools: 2,6,11 / 4,8,11
View Map
Sequence
Unigene: MgU223 (Build 5)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 267-343 bp
TCTATATGAAATCAGCGTCGCCGTGAAAGTGGTGCAAATCTGGATGCGGTCCTCCTT
GCCCAGGCCTCCGTGGATTTC

>Exon-2 344-418 bp
CTCACAAATCGACCCGGTTCGAAACCAGGTACTCCAGGAGGTCCATATGGATCAAATCG
AGCGCCAGGTGGCACAC

>Exon-3 419-485 bp
CCCTGTAGACCTCCAGGCAAGCCAGGTTCAGGAGCTCCACCTCCGAAGAAAATTGGATTGT
TAGGACC

>Exon-4 486-517 bp
CCACTAGCATGCTTCCACCGCCAAAATCACCCC

>Exon-5 518-595 bp
CTGGTAGGATACATTCCAGCTCCAGGCCCAGGAAAGAGATCACTGCCACCAAAACCAGGTA
CCAGAGGAACAACATATC

>Exon-6 596-673 bp
CCAgGAGCTGGAGTATATGGATTTTCAGGGTTATCGACGCCAAGTCTTGGCCTATCTTCTC
TTAAATTTGTCGCAGAAC

>Exon-7 674-823 bp
CTCGAGGGTTGACTTGAAGACTtCTTCGAGGTCGAAGCAGCACTCAGTTTATCCAAAATCT
GTCTATTAACATCCGTTACCAGCTTACCCAAATTCTTGAACTGCGaagCATAACTTGTCT
CCGGTTTATCTTCAACATGTTCTTCAACCT

>Exon-8 824-996 bp
TCGATTTCGAGATGTAGAGACTCCAAATCACCATTCCTCAAAGCATCAACAAGCAATATTT
CGTTCATTACGAGACACTTCACCAGCACTTTCTTTGAATTTTTGTCAGGATAAGAGTACA
GGAATGCATAATTATCTTCAAATTCGTTCCAACCGTCCATCCCCANCTTCATC

>Exon-9 997-1170 bp
CGGTCGAGGAGGACGAGAGAACATCGTCGGCGAAAGCAGAAGAGCCGGTAGCGTGAAGAAC
ATAACCGGCGGCAACAAACGCGGAGTGAACGGCGAACGCCGCTTTGTCGTGGCGGTTCCG
GAATGAAGGTCGCGCCGCCCGTATCACGGCCAAAATCGACTGTTCGGTCGCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: