MgSTS47

Genetic marker
Map(s): Not Mapped
Forward primer: GAGCTTGATGGGTGGCTTAG
Reverse primer: AATGTTGCCAAAGGCATAGG
Tm: 0.0
Physical marker
Overgo sequence fw: GTCTCTCATGGATTTGCAGTGGCT
                ||||||||
Overgo sequence rv:                 GTCACCGAACTGACAAGCATAGCG
Tm: 65.4
Set: D
Pools: 1,10,11
View Map
Sequence
Unigene: MgU222 (Build 7)
EstWise File: View EstWise File in Separate Window)
Predicted Exons Based on EPIC Pipeline (Build 1): >Exon-1 141-264 bp
AAGCATCAACTTTTGCTGCTGCAGAGGCATAACTTACACTGCTGTCTCTCATGGATTTGC
AGTGGCTTGACTGTTCGTATCGC
AAAAATCGAATCTTTATCTTTGTTGAGCTACTCTTC
AACATA

>Exon-2 265-439 bp
ATGAAGAAAAACACTAATTGGATGTCGTCCACAAATAGTATTGTCCGTCTCCAAGAGATAC
TGCTTAAATGCATCTGGATCTCCTGTCTCTATTATATCCATTCCCGATTTATCCAATGCC
TCAATAGACTTGTGGATAGCTCCATGTTTTTTATCATAATGCGTGTAGTTGAATC

>Exon-3 440-583 bp
CGTGAACCCCAGTGACAAAAATCTGAAGAGACAGAAAAGAAATTTGTTGGATCATCCACAT
ATTTGGCTAATAGTCGACCATACATGGCTTCAGTTTCAGCACTGAGAGCACCGACCAGAA
TGGGCACAACTTTCACAGAATACC

>Exon-4 584-695 bp
CCCTGGAATACTTTAACTAGATAGGGAAGGTGCATTTCCATGCTATGCTCAGCCTCATCAA
AATGAAGATCCATGAATTCAAACTTCCCAGTAGCTTTAAGCTCCTCATTGAC

>Exon-5 696-808 bp
CTTGTAGATCAATTGGTAGGTCACCTATGGGGGTCTTGTAGAGTGTAGCTTTTGAAAGAGC
ACATTTGGGAGTGTAATGGTGGTGAGATGGGCCAAGAAGAAACACCCTAGAGA

>Exon-6 809-877 bp
ATGTTTTCAGGATCAATGTTGCCAAAGGCATAGGCTGCAGCACGGCCAGAGTATGAATA
ACCTGCATGAG

>Exon-7 878-962 bp
GGTGCAATAACAGCTCTTACATCTGAAGATTGGGCAACCCCGCAATCCCTAAGCCACCCA
TCAAGCTC
TTCCCCTAACTTTTTAGG

>Exon-8 963-1014 bp
GATTGTCGGTGTACCATGAACCAGCGTNGAGATGCTCTCCTGATCTTGTCCAT



**Underline = Overgo
**Bold = Primers
Polymorphism
Genotypes: